ID: 1049328537

View in Genome Browser
Species Human (GRCh38)
Location 8:142037675-142037697
Sequence TCCACTATAGACACTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049328537_1049328541 7 Left 1049328537 8:142037675-142037697 CCCTGCACAGTGTCTATAGTGGA No data
Right 1049328541 8:142037705-142037727 GCTGTCGACTGAACCTCCTGAGG No data
1049328537_1049328545 21 Left 1049328537 8:142037675-142037697 CCCTGCACAGTGTCTATAGTGGA No data
Right 1049328545 8:142037719-142037741 CTCCTGAGGAGGACAGGCCCAGG No data
1049328537_1049328542 10 Left 1049328537 8:142037675-142037697 CCCTGCACAGTGTCTATAGTGGA No data
Right 1049328542 8:142037708-142037730 GTCGACTGAACCTCCTGAGGAGG No data
1049328537_1049328543 15 Left 1049328537 8:142037675-142037697 CCCTGCACAGTGTCTATAGTGGA No data
Right 1049328543 8:142037713-142037735 CTGAACCTCCTGAGGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049328537 Original CRISPR TCCACTATAGACACTGTGCA GGG (reversed) Intergenic
No off target data available for this crispr