ID: 1049328538

View in Genome Browser
Species Human (GRCh38)
Location 8:142037676-142037698
Sequence GTCCACTATAGACACTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049328538_1049328545 20 Left 1049328538 8:142037676-142037698 CCTGCACAGTGTCTATAGTGGAC No data
Right 1049328545 8:142037719-142037741 CTCCTGAGGAGGACAGGCCCAGG No data
1049328538_1049328542 9 Left 1049328538 8:142037676-142037698 CCTGCACAGTGTCTATAGTGGAC No data
Right 1049328542 8:142037708-142037730 GTCGACTGAACCTCCTGAGGAGG No data
1049328538_1049328543 14 Left 1049328538 8:142037676-142037698 CCTGCACAGTGTCTATAGTGGAC No data
Right 1049328543 8:142037713-142037735 CTGAACCTCCTGAGGAGGACAGG No data
1049328538_1049328541 6 Left 1049328538 8:142037676-142037698 CCTGCACAGTGTCTATAGTGGAC No data
Right 1049328541 8:142037705-142037727 GCTGTCGACTGAACCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049328538 Original CRISPR GTCCACTATAGACACTGTGC AGG (reversed) Intergenic
No off target data available for this crispr