ID: 1049328541

View in Genome Browser
Species Human (GRCh38)
Location 8:142037705-142037727
Sequence GCTGTCGACTGAACCTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049328537_1049328541 7 Left 1049328537 8:142037675-142037697 CCCTGCACAGTGTCTATAGTGGA No data
Right 1049328541 8:142037705-142037727 GCTGTCGACTGAACCTCCTGAGG No data
1049328538_1049328541 6 Left 1049328538 8:142037676-142037698 CCTGCACAGTGTCTATAGTGGAC No data
Right 1049328541 8:142037705-142037727 GCTGTCGACTGAACCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049328541 Original CRISPR GCTGTCGACTGAACCTCCTG AGG Intergenic
No off target data available for this crispr