ID: 1049331475

View in Genome Browser
Species Human (GRCh38)
Location 8:142056362-142056384
Sequence CGGCATGAGCAGAGGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049331465_1049331475 15 Left 1049331465 8:142056324-142056346 CCAATGGACATCACACTGAGGGA No data
Right 1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049331475 Original CRISPR CGGCATGAGCAGAGGCAGAG AGG Intergenic
No off target data available for this crispr