ID: 1049331818

View in Genome Browser
Species Human (GRCh38)
Location 8:142058660-142058682
Sequence GAGTCGAATCTGAGCAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049331818_1049331824 0 Left 1049331818 8:142058660-142058682 CCCTTCCTGCTCAGATTCGACTC No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
1049331818_1049331831 27 Left 1049331818 8:142058660-142058682 CCCTTCCTGCTCAGATTCGACTC No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331818_1049331822 -1 Left 1049331818 8:142058660-142058682 CCCTTCCTGCTCAGATTCGACTC No data
Right 1049331822 8:142058682-142058704 CCCCCAGCTCAACCCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049331818 Original CRISPR GAGTCGAATCTGAGCAGGAA GGG (reversed) Intergenic
No off target data available for this crispr