ID: 1049331824

View in Genome Browser
Species Human (GRCh38)
Location 8:142058683-142058705
Sequence CCCCAGCTCAACCCCTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049331820_1049331824 -5 Left 1049331820 8:142058665-142058687 CCTGCTCAGATTCGACTCCCCCA No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
1049331819_1049331824 -1 Left 1049331819 8:142058661-142058683 CCTTCCTGCTCAGATTCGACTCC No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
1049331814_1049331824 21 Left 1049331814 8:142058639-142058661 CCTGCTCCATCTGACAACACCCC No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
1049331816_1049331824 2 Left 1049331816 8:142058658-142058680 CCCCCTTCCTGCTCAGATTCGAC No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
1049331818_1049331824 0 Left 1049331818 8:142058660-142058682 CCCTTCCTGCTCAGATTCGACTC No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
1049331815_1049331824 15 Left 1049331815 8:142058645-142058667 CCATCTGACAACACCCCCTTCCT No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
1049331812_1049331824 26 Left 1049331812 8:142058634-142058656 CCTACCCTGCTCCATCTGACAAC No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
1049331813_1049331824 22 Left 1049331813 8:142058638-142058660 CCCTGCTCCATCTGACAACACCC No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
1049331817_1049331824 1 Left 1049331817 8:142058659-142058681 CCCCTTCCTGCTCAGATTCGACT No data
Right 1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049331824 Original CRISPR CCCCAGCTCAACCCCTTCCT GGG Intergenic
No off target data available for this crispr