ID: 1049331826

View in Genome Browser
Species Human (GRCh38)
Location 8:142058685-142058707
Sequence CTCCCAGGAAGGGGTTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049331826_1049331831 2 Left 1049331826 8:142058685-142058707 CCAGCTCAACCCCTTCCTGGGAG No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049331826 Original CRISPR CTCCCAGGAAGGGGTTGAGC TGG (reversed) Intergenic
No off target data available for this crispr