ID: 1049331827

View in Genome Browser
Species Human (GRCh38)
Location 8:142058694-142058716
Sequence CTGGTGACTCTCCCAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049331827_1049331836 22 Left 1049331827 8:142058694-142058716 CCCCTTCCTGGGAGAGTCACCAG No data
Right 1049331836 8:142058739-142058761 AGTACACAAGTGCTGAGCCCAGG No data
1049331827_1049331831 -7 Left 1049331827 8:142058694-142058716 CCCCTTCCTGGGAGAGTCACCAG No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331827_1049331837 23 Left 1049331827 8:142058694-142058716 CCCCTTCCTGGGAGAGTCACCAG No data
Right 1049331837 8:142058740-142058762 GTACACAAGTGCTGAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049331827 Original CRISPR CTGGTGACTCTCCCAGGAAG GGG (reversed) Intergenic
No off target data available for this crispr