ID: 1049331831

View in Genome Browser
Species Human (GRCh38)
Location 8:142058710-142058732
Sequence TCACCAGCACATCTGTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049331829_1049331831 -9 Left 1049331829 8:142058696-142058718 CCTTCCTGGGAGAGTCACCAGCA No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331816_1049331831 29 Left 1049331816 8:142058658-142058680 CCCCCTTCCTGCTCAGATTCGAC No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331826_1049331831 2 Left 1049331826 8:142058685-142058707 CCAGCTCAACCCCTTCCTGGGAG No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331828_1049331831 -8 Left 1049331828 8:142058695-142058717 CCCTTCCTGGGAGAGTCACCAGC No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331818_1049331831 27 Left 1049331818 8:142058660-142058682 CCCTTCCTGCTCAGATTCGACTC No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331819_1049331831 26 Left 1049331819 8:142058661-142058683 CCTTCCTGCTCAGATTCGACTCC No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331823_1049331831 4 Left 1049331823 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331820_1049331831 22 Left 1049331820 8:142058665-142058687 CCTGCTCAGATTCGACTCCCCCA No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331817_1049331831 28 Left 1049331817 8:142058659-142058681 CCCCTTCCTGCTCAGATTCGACT No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331825_1049331831 3 Left 1049331825 8:142058684-142058706 CCCAGCTCAACCCCTTCCTGGGA No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331821_1049331831 5 Left 1049331821 8:142058682-142058704 CCCCCAGCTCAACCCCTTCCTGG No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data
1049331827_1049331831 -7 Left 1049331827 8:142058694-142058716 CCCCTTCCTGGGAGAGTCACCAG No data
Right 1049331831 8:142058710-142058732 TCACCAGCACATCTGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049331831 Original CRISPR TCACCAGCACATCTGTGCCC AGG Intergenic
No off target data available for this crispr