ID: 1049331928

View in Genome Browser
Species Human (GRCh38)
Location 8:142059227-142059249
Sequence CCGCACCCTGCAGTTTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049331928_1049331934 -10 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331934 8:142059240-142059262 CAGGGTGCGGGGTAGAGGTCAGG No data
1049331928_1049331935 -7 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331935 8:142059243-142059265 GGTGCGGGGTAGAGGTCAGGCGG No data
1049331928_1049331938 12 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331938 8:142059262-142059284 GCGGCAGGAATGATGATGGCTGG No data
1049331928_1049331943 26 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331943 8:142059276-142059298 GATGGCTGGGAAACAGGAAGGGG No data
1049331928_1049331936 -3 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331936 8:142059247-142059269 CGGGGTAGAGGTCAGGCGGCAGG No data
1049331928_1049331939 13 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331939 8:142059263-142059285 CGGCAGGAATGATGATGGCTGGG No data
1049331928_1049331940 20 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331940 8:142059270-142059292 AATGATGATGGCTGGGAAACAGG No data
1049331928_1049331941 24 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331941 8:142059274-142059296 ATGATGGCTGGGAAACAGGAAGG No data
1049331928_1049331942 25 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331942 8:142059275-142059297 TGATGGCTGGGAAACAGGAAGGG No data
1049331928_1049331937 8 Left 1049331928 8:142059227-142059249 CCACACCAAACTGCAGGGTGCGG No data
Right 1049331937 8:142059258-142059280 TCAGGCGGCAGGAATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049331928 Original CRISPR CCGCACCCTGCAGTTTGGTG TGG (reversed) Intergenic
No off target data available for this crispr