ID: 1049334594

View in Genome Browser
Species Human (GRCh38)
Location 8:142076478-142076500
Sequence GGTGGGGCATGAGGCTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049334594_1049334602 14 Left 1049334594 8:142076478-142076500 CCATTCTAGCCTCATGCCCCACC No data
Right 1049334602 8:142076515-142076537 TTGCTGACCATGCCTGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049334594 Original CRISPR GGTGGGGCATGAGGCTAGAA TGG (reversed) Intergenic
No off target data available for this crispr