ID: 1049334895

View in Genome Browser
Species Human (GRCh38)
Location 8:142078777-142078799
Sequence CAAGTTTACCCCCTAGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049334895_1049334898 -4 Left 1049334895 8:142078777-142078799 CCGTTCTCTAGGGGGTAAACTTG No data
Right 1049334898 8:142078796-142078818 CTTGTTTCGTACAAGGATATGGG No data
1049334895_1049334897 -5 Left 1049334895 8:142078777-142078799 CCGTTCTCTAGGGGGTAAACTTG No data
Right 1049334897 8:142078795-142078817 ACTTGTTTCGTACAAGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049334895 Original CRISPR CAAGTTTACCCCCTAGAGAA CGG (reversed) Intergenic
No off target data available for this crispr