ID: 1049335069

View in Genome Browser
Species Human (GRCh38)
Location 8:142079933-142079955
Sequence CTGCAGGTATGGAGGGCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049335056_1049335069 27 Left 1049335056 8:142079883-142079905 CCCTGTGTCCCTCACAGCCCAGG No data
Right 1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG No data
1049335058_1049335069 26 Left 1049335058 8:142079884-142079906 CCTGTGTCCCTCACAGCCCAGGC No data
Right 1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG No data
1049335055_1049335069 30 Left 1049335055 8:142079880-142079902 CCACCCTGTGTCCCTCACAGCCC No data
Right 1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG No data
1049335060_1049335069 18 Left 1049335060 8:142079892-142079914 CCTCACAGCCCAGGCTTGCTCCA No data
Right 1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG No data
1049335061_1049335069 10 Left 1049335061 8:142079900-142079922 CCCAGGCTTGCTCCAGAGCAGCT No data
Right 1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG No data
1049335062_1049335069 9 Left 1049335062 8:142079901-142079923 CCAGGCTTGCTCCAGAGCAGCTG No data
Right 1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG No data
1049335064_1049335069 -2 Left 1049335064 8:142079912-142079934 CCAGAGCAGCTGGTATTTATGCT No data
Right 1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG No data
1049335059_1049335069 19 Left 1049335059 8:142079891-142079913 CCCTCACAGCCCAGGCTTGCTCC No data
Right 1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049335069 Original CRISPR CTGCAGGTATGGAGGGCACA CGG Intergenic
No off target data available for this crispr