ID: 1049336366

View in Genome Browser
Species Human (GRCh38)
Location 8:142088835-142088857
Sequence CAGTCTGCACACAGGCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049336362_1049336366 -4 Left 1049336362 8:142088816-142088838 CCAGGAGCTGAAGGGCCCACAGT No data
Right 1049336366 8:142088835-142088857 CAGTCTGCACACAGGCAGCCCGG No data
1049336356_1049336366 10 Left 1049336356 8:142088802-142088824 CCTGGGGCCGAGCCCCAGGAGCT No data
Right 1049336366 8:142088835-142088857 CAGTCTGCACACAGGCAGCCCGG No data
1049336361_1049336366 -3 Left 1049336361 8:142088815-142088837 CCCAGGAGCTGAAGGGCCCACAG No data
Right 1049336366 8:142088835-142088857 CAGTCTGCACACAGGCAGCCCGG No data
1049336360_1049336366 -2 Left 1049336360 8:142088814-142088836 CCCCAGGAGCTGAAGGGCCCACA No data
Right 1049336366 8:142088835-142088857 CAGTCTGCACACAGGCAGCCCGG No data
1049336359_1049336366 3 Left 1049336359 8:142088809-142088831 CCGAGCCCCAGGAGCTGAAGGGC No data
Right 1049336366 8:142088835-142088857 CAGTCTGCACACAGGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049336366 Original CRISPR CAGTCTGCACACAGGCAGCC CGG Intergenic
No off target data available for this crispr