ID: 1049336412

View in Genome Browser
Species Human (GRCh38)
Location 8:142089041-142089063
Sequence CTGCCCCAGCGCTGCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049336412_1049336424 25 Left 1049336412 8:142089041-142089063 CCCAGTGGGCAGCGCTGGGGCAG No data
Right 1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG No data
1049336412_1049336416 2 Left 1049336412 8:142089041-142089063 CCCAGTGGGCAGCGCTGGGGCAG No data
Right 1049336416 8:142089066-142089088 GGCCTGTCCCACCACTTGCATGG No data
1049336412_1049336422 21 Left 1049336412 8:142089041-142089063 CCCAGTGGGCAGCGCTGGGGCAG No data
Right 1049336422 8:142089085-142089107 ATGGAAGGAGAAGCAGCCTGAGG No data
1049336412_1049336418 6 Left 1049336412 8:142089041-142089063 CCCAGTGGGCAGCGCTGGGGCAG No data
Right 1049336418 8:142089070-142089092 TGTCCCACCACTTGCATGGAAGG No data
1049336412_1049336423 22 Left 1049336412 8:142089041-142089063 CCCAGTGGGCAGCGCTGGGGCAG No data
Right 1049336423 8:142089086-142089108 TGGAAGGAGAAGCAGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049336412 Original CRISPR CTGCCCCAGCGCTGCCCACT GGG (reversed) Intergenic
No off target data available for this crispr