ID: 1049336413

View in Genome Browser
Species Human (GRCh38)
Location 8:142089042-142089064
Sequence TCTGCCCCAGCGCTGCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049336413_1049336418 5 Left 1049336413 8:142089042-142089064 CCAGTGGGCAGCGCTGGGGCAGA No data
Right 1049336418 8:142089070-142089092 TGTCCCACCACTTGCATGGAAGG No data
1049336413_1049336423 21 Left 1049336413 8:142089042-142089064 CCAGTGGGCAGCGCTGGGGCAGA No data
Right 1049336423 8:142089086-142089108 TGGAAGGAGAAGCAGCCTGAGGG No data
1049336413_1049336424 24 Left 1049336413 8:142089042-142089064 CCAGTGGGCAGCGCTGGGGCAGA No data
Right 1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG No data
1049336413_1049336422 20 Left 1049336413 8:142089042-142089064 CCAGTGGGCAGCGCTGGGGCAGA No data
Right 1049336422 8:142089085-142089107 ATGGAAGGAGAAGCAGCCTGAGG No data
1049336413_1049336416 1 Left 1049336413 8:142089042-142089064 CCAGTGGGCAGCGCTGGGGCAGA No data
Right 1049336416 8:142089066-142089088 GGCCTGTCCCACCACTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049336413 Original CRISPR TCTGCCCCAGCGCTGCCCAC TGG (reversed) Intergenic
No off target data available for this crispr