ID: 1049336417

View in Genome Browser
Species Human (GRCh38)
Location 8:142089068-142089090
Sequence TTCCATGCAAGTGGTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049336417_1049336423 -5 Left 1049336417 8:142089068-142089090 CCTGTCCCACCACTTGCATGGAA No data
Right 1049336423 8:142089086-142089108 TGGAAGGAGAAGCAGCCTGAGGG No data
1049336417_1049336427 18 Left 1049336417 8:142089068-142089090 CCTGTCCCACCACTTGCATGGAA No data
Right 1049336427 8:142089109-142089131 TGGAGTACACACTCACTGGCTGG No data
1049336417_1049336426 14 Left 1049336417 8:142089068-142089090 CCTGTCCCACCACTTGCATGGAA No data
Right 1049336426 8:142089105-142089127 AGGGTGGAGTACACACTCACTGG No data
1049336417_1049336429 27 Left 1049336417 8:142089068-142089090 CCTGTCCCACCACTTGCATGGAA No data
Right 1049336429 8:142089118-142089140 CACTCACTGGCTGGGAAAAACGG No data
1049336417_1049336428 19 Left 1049336417 8:142089068-142089090 CCTGTCCCACCACTTGCATGGAA No data
Right 1049336428 8:142089110-142089132 GGAGTACACACTCACTGGCTGGG No data
1049336417_1049336422 -6 Left 1049336417 8:142089068-142089090 CCTGTCCCACCACTTGCATGGAA No data
Right 1049336422 8:142089085-142089107 ATGGAAGGAGAAGCAGCCTGAGG No data
1049336417_1049336424 -2 Left 1049336417 8:142089068-142089090 CCTGTCCCACCACTTGCATGGAA No data
Right 1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049336417 Original CRISPR TTCCATGCAAGTGGTGGGAC AGG (reversed) Intergenic
No off target data available for this crispr