ID: 1049336420

View in Genome Browser
Species Human (GRCh38)
Location 8:142089074-142089096
Sequence TTCTCCTTCCATGCAAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049336420_1049336430 30 Left 1049336420 8:142089074-142089096 CCACCACTTGCATGGAAGGAGAA No data
Right 1049336430 8:142089127-142089149 GCTGGGAAAAACGGCCTATCTGG No data
1049336420_1049336428 13 Left 1049336420 8:142089074-142089096 CCACCACTTGCATGGAAGGAGAA No data
Right 1049336428 8:142089110-142089132 GGAGTACACACTCACTGGCTGGG No data
1049336420_1049336426 8 Left 1049336420 8:142089074-142089096 CCACCACTTGCATGGAAGGAGAA No data
Right 1049336426 8:142089105-142089127 AGGGTGGAGTACACACTCACTGG No data
1049336420_1049336429 21 Left 1049336420 8:142089074-142089096 CCACCACTTGCATGGAAGGAGAA No data
Right 1049336429 8:142089118-142089140 CACTCACTGGCTGGGAAAAACGG No data
1049336420_1049336424 -8 Left 1049336420 8:142089074-142089096 CCACCACTTGCATGGAAGGAGAA No data
Right 1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG No data
1049336420_1049336427 12 Left 1049336420 8:142089074-142089096 CCACCACTTGCATGGAAGGAGAA No data
Right 1049336427 8:142089109-142089131 TGGAGTACACACTCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049336420 Original CRISPR TTCTCCTTCCATGCAAGTGG TGG (reversed) Intergenic
No off target data available for this crispr