ID: 1049336424

View in Genome Browser
Species Human (GRCh38)
Location 8:142089089-142089111
Sequence AAGGAGAAGCAGCCTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049336417_1049336424 -2 Left 1049336417 8:142089068-142089090 CCTGTCCCACCACTTGCATGGAA No data
Right 1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG No data
1049336413_1049336424 24 Left 1049336413 8:142089042-142089064 CCAGTGGGCAGCGCTGGGGCAGA No data
Right 1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG No data
1049336419_1049336424 -7 Left 1049336419 8:142089073-142089095 CCCACCACTTGCATGGAAGGAGA No data
Right 1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG No data
1049336412_1049336424 25 Left 1049336412 8:142089041-142089063 CCCAGTGGGCAGCGCTGGGGCAG No data
Right 1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG No data
1049336420_1049336424 -8 Left 1049336420 8:142089074-142089096 CCACCACTTGCATGGAAGGAGAA No data
Right 1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049336424 Original CRISPR AAGGAGAAGCAGCCTGAGGG TGG Intergenic
No off target data available for this crispr