ID: 1049336488

View in Genome Browser
Species Human (GRCh38)
Location 8:142089405-142089427
Sequence GCTGCTGCAGTCTCCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049336488_1049336489 -2 Left 1049336488 8:142089405-142089427 CCAGCAGTGGAGACTGCAGCAGC No data
Right 1049336489 8:142089426-142089448 GCATAAGCTCCCGCTGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049336488 Original CRISPR GCTGCTGCAGTCTCCACTGC TGG (reversed) Intergenic