ID: 1049337807

View in Genome Browser
Species Human (GRCh38)
Location 8:142095851-142095873
Sequence ATGCCCCCTAGACACCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049337807_1049337818 8 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337818 8:142095882-142095904 GGCTGCAGGAGGGCAGGGTATGG No data
1049337807_1049337821 20 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337821 8:142095894-142095916 GCAGGGTATGGAGGCAGATTGGG No data
1049337807_1049337814 -2 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337814 8:142095872-142095894 ATCCAGACGGGGCTGCAGGAGGG No data
1049337807_1049337816 2 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337816 8:142095876-142095898 AGACGGGGCTGCAGGAGGGCAGG No data
1049337807_1049337820 19 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337820 8:142095893-142095915 GGCAGGGTATGGAGGCAGATTGG No data
1049337807_1049337817 3 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337817 8:142095877-142095899 GACGGGGCTGCAGGAGGGCAGGG No data
1049337807_1049337813 -3 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337813 8:142095871-142095893 CATCCAGACGGGGCTGCAGGAGG No data
1049337807_1049337812 -6 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337812 8:142095868-142095890 GGGCATCCAGACGGGGCTGCAGG No data
1049337807_1049337822 21 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337822 8:142095895-142095917 CAGGGTATGGAGGCAGATTGGGG No data
1049337807_1049337819 11 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337819 8:142095885-142095907 TGCAGGAGGGCAGGGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049337807 Original CRISPR ATGCCCCCTAGACACCCCAA GGG (reversed) Intergenic
No off target data available for this crispr