ID: 1049337815

View in Genome Browser
Species Human (GRCh38)
Location 8:142095874-142095896
Sequence TGCCCTCCTGCAGCCCCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049337815_1049337823 16 Left 1049337815 8:142095874-142095896 CCAGACGGGGCTGCAGGAGGGCA No data
Right 1049337823 8:142095913-142095935 TGGGGTGCACTACAGATGAGAGG No data
1049337815_1049337821 -3 Left 1049337815 8:142095874-142095896 CCAGACGGGGCTGCAGGAGGGCA No data
Right 1049337821 8:142095894-142095916 GCAGGGTATGGAGGCAGATTGGG No data
1049337815_1049337820 -4 Left 1049337815 8:142095874-142095896 CCAGACGGGGCTGCAGGAGGGCA No data
Right 1049337820 8:142095893-142095915 GGCAGGGTATGGAGGCAGATTGG No data
1049337815_1049337822 -2 Left 1049337815 8:142095874-142095896 CCAGACGGGGCTGCAGGAGGGCA No data
Right 1049337822 8:142095895-142095917 CAGGGTATGGAGGCAGATTGGGG No data
1049337815_1049337824 17 Left 1049337815 8:142095874-142095896 CCAGACGGGGCTGCAGGAGGGCA No data
Right 1049337824 8:142095914-142095936 GGGGTGCACTACAGATGAGAGGG No data
1049337815_1049337825 24 Left 1049337815 8:142095874-142095896 CCAGACGGGGCTGCAGGAGGGCA No data
Right 1049337825 8:142095921-142095943 ACTACAGATGAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049337815 Original CRISPR TGCCCTCCTGCAGCCCCGTC TGG (reversed) Intergenic
No off target data available for this crispr