ID: 1049337819

View in Genome Browser
Species Human (GRCh38)
Location 8:142095885-142095907
Sequence TGCAGGAGGGCAGGGTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049337808_1049337819 10 Left 1049337808 8:142095852-142095874 CCTTGGGGTGTCTAGGGGGCATC No data
Right 1049337819 8:142095885-142095907 TGCAGGAGGGCAGGGTATGGAGG No data
1049337807_1049337819 11 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337819 8:142095885-142095907 TGCAGGAGGGCAGGGTATGGAGG No data
1049337806_1049337819 12 Left 1049337806 8:142095850-142095872 CCCCTTGGGGTGTCTAGGGGGCA No data
Right 1049337819 8:142095885-142095907 TGCAGGAGGGCAGGGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049337819 Original CRISPR TGCAGGAGGGCAGGGTATGG AGG Intergenic
No off target data available for this crispr