ID: 1049337820

View in Genome Browser
Species Human (GRCh38)
Location 8:142095893-142095915
Sequence GGCAGGGTATGGAGGCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049337806_1049337820 20 Left 1049337806 8:142095850-142095872 CCCCTTGGGGTGTCTAGGGGGCA No data
Right 1049337820 8:142095893-142095915 GGCAGGGTATGGAGGCAGATTGG No data
1049337808_1049337820 18 Left 1049337808 8:142095852-142095874 CCTTGGGGTGTCTAGGGGGCATC No data
Right 1049337820 8:142095893-142095915 GGCAGGGTATGGAGGCAGATTGG No data
1049337807_1049337820 19 Left 1049337807 8:142095851-142095873 CCCTTGGGGTGTCTAGGGGGCAT No data
Right 1049337820 8:142095893-142095915 GGCAGGGTATGGAGGCAGATTGG No data
1049337815_1049337820 -4 Left 1049337815 8:142095874-142095896 CCAGACGGGGCTGCAGGAGGGCA No data
Right 1049337820 8:142095893-142095915 GGCAGGGTATGGAGGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049337820 Original CRISPR GGCAGGGTATGGAGGCAGAT TGG Intergenic
No off target data available for this crispr