ID: 1049337824

View in Genome Browser
Species Human (GRCh38)
Location 8:142095914-142095936
Sequence GGGGTGCACTACAGATGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049337815_1049337824 17 Left 1049337815 8:142095874-142095896 CCAGACGGGGCTGCAGGAGGGCA No data
Right 1049337824 8:142095914-142095936 GGGGTGCACTACAGATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049337824 Original CRISPR GGGGTGCACTACAGATGAGA GGG Intergenic
No off target data available for this crispr