ID: 1049337825

View in Genome Browser
Species Human (GRCh38)
Location 8:142095921-142095943
Sequence ACTACAGATGAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049337815_1049337825 24 Left 1049337815 8:142095874-142095896 CCAGACGGGGCTGCAGGAGGGCA No data
Right 1049337825 8:142095921-142095943 ACTACAGATGAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049337825 Original CRISPR ACTACAGATGAGAGGGAAGC AGG Intergenic
No off target data available for this crispr