ID: 1049339116

View in Genome Browser
Species Human (GRCh38)
Location 8:142102520-142102542
Sequence GCATCCAGGTTGGCAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049339116_1049339130 20 Left 1049339116 8:142102520-142102542 CCCTTCCCTGCCAACCTGGATGC No data
Right 1049339130 8:142102563-142102585 CTGCCCCACCTCCTTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049339116 Original CRISPR GCATCCAGGTTGGCAGGGAA GGG (reversed) Intergenic
No off target data available for this crispr