ID: 1049341431

View in Genome Browser
Species Human (GRCh38)
Location 8:142114646-142114668
Sequence CTTTGAGAGAAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049341427_1049341431 9 Left 1049341427 8:142114614-142114636 CCCAGCCTGGTGCTTGACACACA No data
Right 1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG No data
1049341425_1049341431 20 Left 1049341425 8:142114603-142114625 CCACTGACCATCCCAGCCTGGTG No data
Right 1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG No data
1049341429_1049341431 4 Left 1049341429 8:142114619-142114641 CCTGGTGCTTGACACACACTCAG No data
Right 1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG No data
1049341422_1049341431 24 Left 1049341422 8:142114599-142114621 CCTCCCACTGACCATCCCAGCCT No data
Right 1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG No data
1049341426_1049341431 13 Left 1049341426 8:142114610-142114632 CCATCCCAGCCTGGTGCTTGACA No data
Right 1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG No data
1049341428_1049341431 8 Left 1049341428 8:142114615-142114637 CCAGCCTGGTGCTTGACACACAC No data
Right 1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG No data
1049341424_1049341431 21 Left 1049341424 8:142114602-142114624 CCCACTGACCATCCCAGCCTGGT No data
Right 1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049341431 Original CRISPR CTTTGAGAGAAGAAGGAAGA AGG Intergenic
No off target data available for this crispr