ID: 1049343210

View in Genome Browser
Species Human (GRCh38)
Location 8:142124816-142124838
Sequence CCCCTGGGGTCCCCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049343204_1049343210 -9 Left 1049343204 8:142124802-142124824 CCAGAGCCCAGAAACCCCTGGGG No data
Right 1049343210 8:142124816-142124838 CCCCTGGGGTCCCCTGAGGCTGG No data
1049343194_1049343210 30 Left 1049343194 8:142124763-142124785 CCGGGTCAAGGACAGAGGCAGAG No data
Right 1049343210 8:142124816-142124838 CCCCTGGGGTCCCCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049343210 Original CRISPR CCCCTGGGGTCCCCTGAGGC TGG Intergenic
No off target data available for this crispr