ID: 1049343888

View in Genome Browser
Species Human (GRCh38)
Location 8:142128323-142128345
Sequence CGGGGGACGCAGGCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049343876_1049343888 9 Left 1049343876 8:142128291-142128313 CCCACACTATCCAGTGTATGGGC No data
Right 1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG No data
1049343872_1049343888 16 Left 1049343872 8:142128284-142128306 CCTACACCCCACACTATCCAGTG No data
Right 1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG No data
1049343877_1049343888 8 Left 1049343877 8:142128292-142128314 CCACACTATCCAGTGTATGGGCC No data
Right 1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG No data
1049343880_1049343888 -1 Left 1049343880 8:142128301-142128323 CCAGTGTATGGGCCGAGGGCTGC No data
Right 1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG No data
1049343871_1049343888 17 Left 1049343871 8:142128283-142128305 CCCTACACCCCACACTATCCAGT No data
Right 1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG No data
1049343870_1049343888 26 Left 1049343870 8:142128274-142128296 CCGTTTGCACCCTACACCCCACA No data
Right 1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG No data
1049343874_1049343888 10 Left 1049343874 8:142128290-142128312 CCCCACACTATCCAGTGTATGGG No data
Right 1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049343888 Original CRISPR CGGGGGACGCAGGCCAGGAG AGG Intergenic
No off target data available for this crispr