ID: 1049344634

View in Genome Browser
Species Human (GRCh38)
Location 8:142131903-142131925
Sequence TCCGGAGAGCTGCTGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049344634_1049344640 -4 Left 1049344634 8:142131903-142131925 CCTGTGCCCAGCAGCTCTCCGGA No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344634_1049344638 -10 Left 1049344634 8:142131903-142131925 CCTGTGCCCAGCAGCTCTCCGGA No data
Right 1049344638 8:142131916-142131938 GCTCTCCGGAGGCCATGCTGTGG No data
1049344634_1049344643 22 Left 1049344634 8:142131903-142131925 CCTGTGCCCAGCAGCTCTCCGGA No data
Right 1049344643 8:142131948-142131970 CCCATTGTTTTTCTTCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049344634 Original CRISPR TCCGGAGAGCTGCTGGGCAC AGG (reversed) Intergenic
No off target data available for this crispr