ID: 1049344640

View in Genome Browser
Species Human (GRCh38)
Location 8:142131922-142131944
Sequence CGGAGGCCATGCTGTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049344624_1049344640 19 Left 1049344624 8:142131880-142131902 CCGGGCCGGCCCCCACCTTCCCT No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344623_1049344640 20 Left 1049344623 8:142131879-142131901 CCCGGGCCGGCCCCCACCTTCCC No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344629_1049344640 7 Left 1049344629 8:142131892-142131914 CCACCTTCCCTCCTGTGCCCAGC No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344620_1049344640 23 Left 1049344620 8:142131876-142131898 CCCCCCGGGCCGGCCCCCACCTT No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344632_1049344640 -1 Left 1049344632 8:142131900-142131922 CCTCCTGTGCCCAGCAGCTCTCC No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344621_1049344640 22 Left 1049344621 8:142131877-142131899 CCCCCGGGCCGGCCCCCACCTTC No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344622_1049344640 21 Left 1049344622 8:142131878-142131900 CCCCGGGCCGGCCCCCACCTTCC No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344627_1049344640 9 Left 1049344627 8:142131890-142131912 CCCCACCTTCCCTCCTGTGCCCA No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344628_1049344640 8 Left 1049344628 8:142131891-142131913 CCCACCTTCCCTCCTGTGCCCAG No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344626_1049344640 10 Left 1049344626 8:142131889-142131911 CCCCCACCTTCCCTCCTGTGCCC No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344631_1049344640 0 Left 1049344631 8:142131899-142131921 CCCTCCTGTGCCCAGCAGCTCTC No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344636_1049344640 -10 Left 1049344636 8:142131909-142131931 CCCAGCAGCTCTCCGGAGGCCAT No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344634_1049344640 -4 Left 1049344634 8:142131903-142131925 CCTGTGCCCAGCAGCTCTCCGGA No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344630_1049344640 4 Left 1049344630 8:142131895-142131917 CCTTCCCTCCTGTGCCCAGCAGC No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data
1049344625_1049344640 14 Left 1049344625 8:142131885-142131907 CCGGCCCCCACCTTCCCTCCTGT No data
Right 1049344640 8:142131922-142131944 CGGAGGCCATGCTGTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049344640 Original CRISPR CGGAGGCCATGCTGTGGAGA TGG Intergenic
No off target data available for this crispr