ID: 1049344643

View in Genome Browser
Species Human (GRCh38)
Location 8:142131948-142131970
Sequence CCCATTGTTTTTCTTCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049344630_1049344643 30 Left 1049344630 8:142131895-142131917 CCTTCCCTCCTGTGCCCAGCAGC No data
Right 1049344643 8:142131948-142131970 CCCATTGTTTTTCTTCTTTCAGG No data
1049344637_1049344643 15 Left 1049344637 8:142131910-142131932 CCAGCAGCTCTCCGGAGGCCATG No data
Right 1049344643 8:142131948-142131970 CCCATTGTTTTTCTTCTTTCAGG No data
1049344634_1049344643 22 Left 1049344634 8:142131903-142131925 CCTGTGCCCAGCAGCTCTCCGGA No data
Right 1049344643 8:142131948-142131970 CCCATTGTTTTTCTTCTTTCAGG No data
1049344636_1049344643 16 Left 1049344636 8:142131909-142131931 CCCAGCAGCTCTCCGGAGGCCAT No data
Right 1049344643 8:142131948-142131970 CCCATTGTTTTTCTTCTTTCAGG No data
1049344641_1049344643 -3 Left 1049344641 8:142131928-142131950 CCATGCTGTGGAGATGGAATCCC No data
Right 1049344643 8:142131948-142131970 CCCATTGTTTTTCTTCTTTCAGG No data
1049344631_1049344643 26 Left 1049344631 8:142131899-142131921 CCCTCCTGTGCCCAGCAGCTCTC No data
Right 1049344643 8:142131948-142131970 CCCATTGTTTTTCTTCTTTCAGG No data
1049344632_1049344643 25 Left 1049344632 8:142131900-142131922 CCTCCTGTGCCCAGCAGCTCTCC No data
Right 1049344643 8:142131948-142131970 CCCATTGTTTTTCTTCTTTCAGG No data
1049344639_1049344643 4 Left 1049344639 8:142131921-142131943 CCGGAGGCCATGCTGTGGAGATG No data
Right 1049344643 8:142131948-142131970 CCCATTGTTTTTCTTCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049344643 Original CRISPR CCCATTGTTTTTCTTCTTTC AGG Intergenic
No off target data available for this crispr