ID: 1049345914

View in Genome Browser
Species Human (GRCh38)
Location 8:142138551-142138573
Sequence CAGGGCTACCACATAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049345914_1049345919 6 Left 1049345914 8:142138551-142138573 CCAGGGCCTATGTGGTAGCCCTG No data
Right 1049345919 8:142138580-142138602 AAGGAGCAGTCCCTCTGCTGCGG No data
1049345914_1049345920 9 Left 1049345914 8:142138551-142138573 CCAGGGCCTATGTGGTAGCCCTG No data
Right 1049345920 8:142138583-142138605 GAGCAGTCCCTCTGCTGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049345914 Original CRISPR CAGGGCTACCACATAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr