ID: 1049348974

View in Genome Browser
Species Human (GRCh38)
Location 8:142154001-142154023
Sequence CGCACGGCACTCGATGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049348974_1049348983 17 Left 1049348974 8:142154001-142154023 CCTGCAACATCGAGTGCCGTGCG No data
Right 1049348983 8:142154041-142154063 TGTCCATGGGGAAACGGCCCTGG No data
1049348974_1049348986 21 Left 1049348974 8:142154001-142154023 CCTGCAACATCGAGTGCCGTGCG No data
Right 1049348986 8:142154045-142154067 CATGGGGAAACGGCCCTGGGAGG No data
1049348974_1049348977 3 Left 1049348974 8:142154001-142154023 CCTGCAACATCGAGTGCCGTGCG No data
Right 1049348977 8:142154027-142154049 AGCCGTGCTGTCCATGTCCATGG No data
1049348974_1049348984 18 Left 1049348974 8:142154001-142154023 CCTGCAACATCGAGTGCCGTGCG No data
Right 1049348984 8:142154042-142154064 GTCCATGGGGAAACGGCCCTGGG No data
1049348974_1049348980 5 Left 1049348974 8:142154001-142154023 CCTGCAACATCGAGTGCCGTGCG No data
Right 1049348980 8:142154029-142154051 CCGTGCTGTCCATGTCCATGGGG No data
1049348974_1049348978 4 Left 1049348974 8:142154001-142154023 CCTGCAACATCGAGTGCCGTGCG No data
Right 1049348978 8:142154028-142154050 GCCGTGCTGTCCATGTCCATGGG No data
1049348974_1049348981 11 Left 1049348974 8:142154001-142154023 CCTGCAACATCGAGTGCCGTGCG No data
Right 1049348981 8:142154035-142154057 TGTCCATGTCCATGGGGAAACGG No data
1049348974_1049348987 22 Left 1049348974 8:142154001-142154023 CCTGCAACATCGAGTGCCGTGCG No data
Right 1049348987 8:142154046-142154068 ATGGGGAAACGGCCCTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049348974 Original CRISPR CGCACGGCACTCGATGTTGC AGG (reversed) Intergenic
No off target data available for this crispr