ID: 1049348976

View in Genome Browser
Species Human (GRCh38)
Location 8:142154017-142154039
Sequence GGACAGCACGGCTCCACGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049348976_1049348986 5 Left 1049348976 8:142154017-142154039 CCGTGCGTGGAGCCGTGCTGTCC No data
Right 1049348986 8:142154045-142154067 CATGGGGAAACGGCCCTGGGAGG No data
1049348976_1049348983 1 Left 1049348976 8:142154017-142154039 CCGTGCGTGGAGCCGTGCTGTCC No data
Right 1049348983 8:142154041-142154063 TGTCCATGGGGAAACGGCCCTGG No data
1049348976_1049348981 -5 Left 1049348976 8:142154017-142154039 CCGTGCGTGGAGCCGTGCTGTCC No data
Right 1049348981 8:142154035-142154057 TGTCCATGTCCATGGGGAAACGG No data
1049348976_1049348984 2 Left 1049348976 8:142154017-142154039 CCGTGCGTGGAGCCGTGCTGTCC No data
Right 1049348984 8:142154042-142154064 GTCCATGGGGAAACGGCCCTGGG No data
1049348976_1049348987 6 Left 1049348976 8:142154017-142154039 CCGTGCGTGGAGCCGTGCTGTCC No data
Right 1049348987 8:142154046-142154068 ATGGGGAAACGGCCCTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049348976 Original CRISPR GGACAGCACGGCTCCACGCA CGG (reversed) Intergenic
No off target data available for this crispr