ID: 1049348979

View in Genome Browser
Species Human (GRCh38)
Location 8:142154029-142154051
Sequence CCCCATGGACATGGACAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049348979_1049348987 -6 Left 1049348979 8:142154029-142154051 CCGTGCTGTCCATGTCCATGGGG No data
Right 1049348987 8:142154046-142154068 ATGGGGAAACGGCCCTGGGAGGG No data
1049348979_1049348984 -10 Left 1049348979 8:142154029-142154051 CCGTGCTGTCCATGTCCATGGGG No data
Right 1049348984 8:142154042-142154064 GTCCATGGGGAAACGGCCCTGGG No data
1049348979_1049348986 -7 Left 1049348979 8:142154029-142154051 CCGTGCTGTCCATGTCCATGGGG No data
Right 1049348986 8:142154045-142154067 CATGGGGAAACGGCCCTGGGAGG No data
1049348979_1049348992 28 Left 1049348979 8:142154029-142154051 CCGTGCTGTCCATGTCCATGGGG No data
Right 1049348992 8:142154080-142154102 CTTGCAGCTCTCCCCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049348979 Original CRISPR CCCCATGGACATGGACAGCA CGG (reversed) Intergenic
No off target data available for this crispr