ID: 1049348984

View in Genome Browser
Species Human (GRCh38)
Location 8:142154042-142154064
Sequence GTCCATGGGGAAACGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049348973_1049348984 30 Left 1049348973 8:142153989-142154011 CCAGAGTTGCAGCCTGCAACATC No data
Right 1049348984 8:142154042-142154064 GTCCATGGGGAAACGGCCCTGGG No data
1049348974_1049348984 18 Left 1049348974 8:142154001-142154023 CCTGCAACATCGAGTGCCGTGCG No data
Right 1049348984 8:142154042-142154064 GTCCATGGGGAAACGGCCCTGGG No data
1049348976_1049348984 2 Left 1049348976 8:142154017-142154039 CCGTGCGTGGAGCCGTGCTGTCC No data
Right 1049348984 8:142154042-142154064 GTCCATGGGGAAACGGCCCTGGG No data
1049348979_1049348984 -10 Left 1049348979 8:142154029-142154051 CCGTGCTGTCCATGTCCATGGGG No data
Right 1049348984 8:142154042-142154064 GTCCATGGGGAAACGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049348984 Original CRISPR GTCCATGGGGAAACGGCCCT GGG Intergenic
No off target data available for this crispr