ID: 1049348992

View in Genome Browser
Species Human (GRCh38)
Location 8:142154080-142154102
Sequence CTTGCAGCTCTCCCCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049348989_1049348992 -2 Left 1049348989 8:142154059-142154081 CCTGGGAGGGCATTGCTCCCTCT No data
Right 1049348992 8:142154080-142154102 CTTGCAGCTCTCCCCACAGCAGG No data
1049348979_1049348992 28 Left 1049348979 8:142154029-142154051 CCGTGCTGTCCATGTCCATGGGG No data
Right 1049348992 8:142154080-142154102 CTTGCAGCTCTCCCCACAGCAGG No data
1049348985_1049348992 13 Left 1049348985 8:142154044-142154066 CCATGGGGAAACGGCCCTGGGAG No data
Right 1049348992 8:142154080-142154102 CTTGCAGCTCTCCCCACAGCAGG No data
1049348982_1049348992 19 Left 1049348982 8:142154038-142154060 CCATGTCCATGGGGAAACGGCCC No data
Right 1049348992 8:142154080-142154102 CTTGCAGCTCTCCCCACAGCAGG No data
1049348988_1049348992 -1 Left 1049348988 8:142154058-142154080 CCCTGGGAGGGCATTGCTCCCTC No data
Right 1049348992 8:142154080-142154102 CTTGCAGCTCTCCCCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049348992 Original CRISPR CTTGCAGCTCTCCCCACAGC AGG Intergenic
No off target data available for this crispr