ID: 1049349652

View in Genome Browser
Species Human (GRCh38)
Location 8:142157701-142157723
Sequence CGGTCTAGCCGGGGAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049349652_1049349662 -2 Left 1049349652 8:142157701-142157723 CCCTCCACTCCCCGGCTAGACCG No data
Right 1049349662 8:142157722-142157744 CGCTGCTCCTTGCATGCTGGGGG No data
1049349652_1049349659 -4 Left 1049349652 8:142157701-142157723 CCCTCCACTCCCCGGCTAGACCG No data
Right 1049349659 8:142157720-142157742 ACCGCTGCTCCTTGCATGCTGGG No data
1049349652_1049349658 -5 Left 1049349652 8:142157701-142157723 CCCTCCACTCCCCGGCTAGACCG No data
Right 1049349658 8:142157719-142157741 GACCGCTGCTCCTTGCATGCTGG No data
1049349652_1049349663 4 Left 1049349652 8:142157701-142157723 CCCTCCACTCCCCGGCTAGACCG No data
Right 1049349663 8:142157728-142157750 TCCTTGCATGCTGGGGGAAGTGG No data
1049349652_1049349661 -3 Left 1049349652 8:142157701-142157723 CCCTCCACTCCCCGGCTAGACCG No data
Right 1049349661 8:142157721-142157743 CCGCTGCTCCTTGCATGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049349652 Original CRISPR CGGTCTAGCCGGGGAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr