ID: 1049353013

View in Genome Browser
Species Human (GRCh38)
Location 8:142174350-142174372
Sequence ATTGTGGGAGTCGCAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049353013_1049353019 2 Left 1049353013 8:142174350-142174372 CCAGTGGCTGCGACTCCCACAAT No data
Right 1049353019 8:142174375-142174397 CTCATCAGGATCCTTTGTTGGGG No data
1049353013_1049353020 3 Left 1049353013 8:142174350-142174372 CCAGTGGCTGCGACTCCCACAAT No data
Right 1049353020 8:142174376-142174398 TCATCAGGATCCTTTGTTGGGGG No data
1049353013_1049353022 20 Left 1049353013 8:142174350-142174372 CCAGTGGCTGCGACTCCCACAAT No data
Right 1049353022 8:142174393-142174415 TGGGGGTCGTGTGTGCCCTAAGG No data
1049353013_1049353023 21 Left 1049353013 8:142174350-142174372 CCAGTGGCTGCGACTCCCACAAT No data
Right 1049353023 8:142174394-142174416 GGGGGTCGTGTGTGCCCTAAGGG No data
1049353013_1049353024 24 Left 1049353013 8:142174350-142174372 CCAGTGGCTGCGACTCCCACAAT No data
Right 1049353024 8:142174397-142174419 GGTCGTGTGTGCCCTAAGGGAGG No data
1049353013_1049353018 1 Left 1049353013 8:142174350-142174372 CCAGTGGCTGCGACTCCCACAAT No data
Right 1049353018 8:142174374-142174396 ACTCATCAGGATCCTTTGTTGGG No data
1049353013_1049353017 0 Left 1049353013 8:142174350-142174372 CCAGTGGCTGCGACTCCCACAAT No data
Right 1049353017 8:142174373-142174395 GACTCATCAGGATCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049353013 Original CRISPR ATTGTGGGAGTCGCAGCCAC TGG (reversed) Intergenic
No off target data available for this crispr