ID: 1049353049

View in Genome Browser
Species Human (GRCh38)
Location 8:142174502-142174524
Sequence CCTGAGAAGCAGGCAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049353049_1049353058 -4 Left 1049353049 8:142174502-142174524 CCCTCTGCTGCCTGCTTCTCAGG No data
Right 1049353058 8:142174521-142174543 CAGGGCTGGCCCTAGGCCAGGGG No data
1049353049_1049353057 -5 Left 1049353049 8:142174502-142174524 CCCTCTGCTGCCTGCTTCTCAGG No data
Right 1049353057 8:142174520-142174542 TCAGGGCTGGCCCTAGGCCAGGG No data
1049353049_1049353056 -6 Left 1049353049 8:142174502-142174524 CCCTCTGCTGCCTGCTTCTCAGG No data
Right 1049353056 8:142174519-142174541 CTCAGGGCTGGCCCTAGGCCAGG No data
1049353049_1049353064 23 Left 1049353049 8:142174502-142174524 CCCTCTGCTGCCTGCTTCTCAGG No data
Right 1049353064 8:142174548-142174570 CAGACCAAAAACCTTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049353049 Original CRISPR CCTGAGAAGCAGGCAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr