ID: 1049355182

View in Genome Browser
Species Human (GRCh38)
Location 8:142184136-142184158
Sequence CCTCTACTCACCTGTAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049355174_1049355182 17 Left 1049355174 8:142184096-142184118 CCGGTGTCAGCTGGTGTCACGCC No data
Right 1049355182 8:142184136-142184158 CCTCTACTCACCTGTAATGCTGG No data
1049355177_1049355182 -5 Left 1049355177 8:142184118-142184140 CCCACCGCTGGCTGCCTGCCTCT No data
Right 1049355182 8:142184136-142184158 CCTCTACTCACCTGTAATGCTGG No data
1049355176_1049355182 -4 Left 1049355176 8:142184117-142184139 CCCCACCGCTGGCTGCCTGCCTC No data
Right 1049355182 8:142184136-142184158 CCTCTACTCACCTGTAATGCTGG No data
1049355178_1049355182 -6 Left 1049355178 8:142184119-142184141 CCACCGCTGGCTGCCTGCCTCTA No data
Right 1049355182 8:142184136-142184158 CCTCTACTCACCTGTAATGCTGG No data
1049355179_1049355182 -9 Left 1049355179 8:142184122-142184144 CCGCTGGCTGCCTGCCTCTACTC No data
Right 1049355182 8:142184136-142184158 CCTCTACTCACCTGTAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049355182 Original CRISPR CCTCTACTCACCTGTAATGC TGG Intergenic
No off target data available for this crispr