ID: 1049356662

View in Genome Browser
Species Human (GRCh38)
Location 8:142192558-142192580
Sequence CATGAAGGCAGCCTCAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049356647_1049356662 30 Left 1049356647 8:142192505-142192527 CCCTGAGCGGGGTCTACAGGGGA No data
Right 1049356662 8:142192558-142192580 CATGAAGGCAGCCTCAGCACTGG No data
1049356657_1049356662 -9 Left 1049356657 8:142192544-142192566 CCACCAGGGGTCCCCATGAAGGC No data
Right 1049356662 8:142192558-142192580 CATGAAGGCAGCCTCAGCACTGG No data
1049356648_1049356662 29 Left 1049356648 8:142192506-142192528 CCTGAGCGGGGTCTACAGGGGAC No data
Right 1049356662 8:142192558-142192580 CATGAAGGCAGCCTCAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049356662 Original CRISPR CATGAAGGCAGCCTCAGCAC TGG Intergenic
No off target data available for this crispr