ID: 1049357854

View in Genome Browser
Species Human (GRCh38)
Location 8:142197558-142197580
Sequence CTCCCTATAAGCAGCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049357854_1049357858 4 Left 1049357854 8:142197558-142197580 CCAGGGCAGCTGCTTATAGGGAG No data
Right 1049357858 8:142197585-142197607 CAACCACCCCTGCATGTGGAGGG No data
1049357854_1049357857 3 Left 1049357854 8:142197558-142197580 CCAGGGCAGCTGCTTATAGGGAG No data
Right 1049357857 8:142197584-142197606 ACAACCACCCCTGCATGTGGAGG No data
1049357854_1049357856 0 Left 1049357854 8:142197558-142197580 CCAGGGCAGCTGCTTATAGGGAG No data
Right 1049357856 8:142197581-142197603 GCAACAACCACCCCTGCATGTGG No data
1049357854_1049357867 23 Left 1049357854 8:142197558-142197580 CCAGGGCAGCTGCTTATAGGGAG No data
Right 1049357867 8:142197604-142197626 AGGGTAGGAGAGGAGGTGGCAGG No data
1049357854_1049357860 8 Left 1049357854 8:142197558-142197580 CCAGGGCAGCTGCTTATAGGGAG No data
Right 1049357860 8:142197589-142197611 CACCCCTGCATGTGGAGGGTAGG No data
1049357854_1049357864 13 Left 1049357854 8:142197558-142197580 CCAGGGCAGCTGCTTATAGGGAG No data
Right 1049357864 8:142197594-142197616 CTGCATGTGGAGGGTAGGAGAGG No data
1049357854_1049357865 16 Left 1049357854 8:142197558-142197580 CCAGGGCAGCTGCTTATAGGGAG No data
Right 1049357865 8:142197597-142197619 CATGTGGAGGGTAGGAGAGGAGG No data
1049357854_1049357866 19 Left 1049357854 8:142197558-142197580 CCAGGGCAGCTGCTTATAGGGAG No data
Right 1049357866 8:142197600-142197622 GTGGAGGGTAGGAGAGGAGGTGG No data
1049357854_1049357868 24 Left 1049357854 8:142197558-142197580 CCAGGGCAGCTGCTTATAGGGAG No data
Right 1049357868 8:142197605-142197627 GGGTAGGAGAGGAGGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049357854 Original CRISPR CTCCCTATAAGCAGCTGCCC TGG (reversed) Intergenic
No off target data available for this crispr