ID: 1049358721

View in Genome Browser
Species Human (GRCh38)
Location 8:142201680-142201702
Sequence CACAGCAGGGAGAGGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049358706_1049358721 30 Left 1049358706 8:142201627-142201649 CCCTGGAAGGAGCTCATTAGAGA No data
Right 1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG No data
1049358711_1049358721 -4 Left 1049358711 8:142201661-142201683 CCACTCAGTGACAGAGACCCACA No data
Right 1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG No data
1049358707_1049358721 29 Left 1049358707 8:142201628-142201650 CCTGGAAGGAGCTCATTAGAGAT No data
Right 1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049358721 Original CRISPR CACAGCAGGGAGAGGGGGGC CGG Intergenic
No off target data available for this crispr