ID: 1049358862

View in Genome Browser
Species Human (GRCh38)
Location 8:142202355-142202377
Sequence CAGAGGGCGGAGACGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049358862_1049358872 16 Left 1049358862 8:142202355-142202377 CCAGCCGCCGTCTCCGCCCTCTG No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358862_1049358870 14 Left 1049358862 8:142202355-142202377 CCAGCCGCCGTCTCCGCCCTCTG No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358862_1049358871 15 Left 1049358862 8:142202355-142202377 CCAGCCGCCGTCTCCGCCCTCTG No data
Right 1049358871 8:142202393-142202415 CACTGCTCCCACCTCTGAGCGGG No data
1049358862_1049358876 28 Left 1049358862 8:142202355-142202377 CCAGCCGCCGTCTCCGCCCTCTG No data
Right 1049358876 8:142202406-142202428 TCTGAGCGGGGCCCCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049358862 Original CRISPR CAGAGGGCGGAGACGGCGGC TGG (reversed) Intergenic
No off target data available for this crispr