ID: 1049358870

View in Genome Browser
Species Human (GRCh38)
Location 8:142202392-142202414
Sequence GCACTGCTCCCACCTCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049358868_1049358870 -3 Left 1049358868 8:142202372-142202394 CCTCTGCCAGGCAGATCAGAGCA No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358865_1049358870 7 Left 1049358865 8:142202362-142202384 CCGTCTCCGCCCTCTGCCAGGCA No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358860_1049358870 18 Left 1049358860 8:142202351-142202373 CCCTCCAGCCGCCGTCTCCGCCC No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358859_1049358870 26 Left 1049358859 8:142202343-142202365 CCTGAGAGCCCTCCAGCCGCCGT No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358866_1049358870 1 Left 1049358866 8:142202368-142202390 CCGCCCTCTGCCAGGCAGATCAG No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358861_1049358870 17 Left 1049358861 8:142202352-142202374 CCTCCAGCCGCCGTCTCCGCCCT No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358863_1049358870 10 Left 1049358863 8:142202359-142202381 CCGCCGTCTCCGCCCTCTGCCAG No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358858_1049358870 27 Left 1049358858 8:142202342-142202364 CCCTGAGAGCCCTCCAGCCGCCG No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358869_1049358870 -9 Left 1049358869 8:142202378-142202400 CCAGGCAGATCAGAGCACTGCTC No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358867_1049358870 -2 Left 1049358867 8:142202371-142202393 CCCTCTGCCAGGCAGATCAGAGC No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data
1049358862_1049358870 14 Left 1049358862 8:142202355-142202377 CCAGCCGCCGTCTCCGCCCTCTG No data
Right 1049358870 8:142202392-142202414 GCACTGCTCCCACCTCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049358870 Original CRISPR GCACTGCTCCCACCTCTGAG CGG Intergenic
No off target data available for this crispr