ID: 1049358872

View in Genome Browser
Species Human (GRCh38)
Location 8:142202394-142202416
Sequence ACTGCTCCCACCTCTGAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049358869_1049358872 -7 Left 1049358869 8:142202378-142202400 CCAGGCAGATCAGAGCACTGCTC No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358860_1049358872 20 Left 1049358860 8:142202351-142202373 CCCTCCAGCCGCCGTCTCCGCCC No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358859_1049358872 28 Left 1049358859 8:142202343-142202365 CCTGAGAGCCCTCCAGCCGCCGT No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358862_1049358872 16 Left 1049358862 8:142202355-142202377 CCAGCCGCCGTCTCCGCCCTCTG No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358861_1049358872 19 Left 1049358861 8:142202352-142202374 CCTCCAGCCGCCGTCTCCGCCCT No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358867_1049358872 0 Left 1049358867 8:142202371-142202393 CCCTCTGCCAGGCAGATCAGAGC No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358868_1049358872 -1 Left 1049358868 8:142202372-142202394 CCTCTGCCAGGCAGATCAGAGCA No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358866_1049358872 3 Left 1049358866 8:142202368-142202390 CCGCCCTCTGCCAGGCAGATCAG No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358858_1049358872 29 Left 1049358858 8:142202342-142202364 CCCTGAGAGCCCTCCAGCCGCCG No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358863_1049358872 12 Left 1049358863 8:142202359-142202381 CCGCCGTCTCCGCCCTCTGCCAG No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data
1049358865_1049358872 9 Left 1049358865 8:142202362-142202384 CCGTCTCCGCCCTCTGCCAGGCA No data
Right 1049358872 8:142202394-142202416 ACTGCTCCCACCTCTGAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049358872 Original CRISPR ACTGCTCCCACCTCTGAGCG GGG Intergenic
No off target data available for this crispr