ID: 1049358876

View in Genome Browser
Species Human (GRCh38)
Location 8:142202406-142202428
Sequence TCTGAGCGGGGCCCCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049358866_1049358876 15 Left 1049358866 8:142202368-142202390 CCGCCCTCTGCCAGGCAGATCAG No data
Right 1049358876 8:142202406-142202428 TCTGAGCGGGGCCCCTGTCCTGG No data
1049358863_1049358876 24 Left 1049358863 8:142202359-142202381 CCGCCGTCTCCGCCCTCTGCCAG No data
Right 1049358876 8:142202406-142202428 TCTGAGCGGGGCCCCTGTCCTGG No data
1049358865_1049358876 21 Left 1049358865 8:142202362-142202384 CCGTCTCCGCCCTCTGCCAGGCA No data
Right 1049358876 8:142202406-142202428 TCTGAGCGGGGCCCCTGTCCTGG No data
1049358868_1049358876 11 Left 1049358868 8:142202372-142202394 CCTCTGCCAGGCAGATCAGAGCA No data
Right 1049358876 8:142202406-142202428 TCTGAGCGGGGCCCCTGTCCTGG No data
1049358862_1049358876 28 Left 1049358862 8:142202355-142202377 CCAGCCGCCGTCTCCGCCCTCTG No data
Right 1049358876 8:142202406-142202428 TCTGAGCGGGGCCCCTGTCCTGG No data
1049358869_1049358876 5 Left 1049358869 8:142202378-142202400 CCAGGCAGATCAGAGCACTGCTC No data
Right 1049358876 8:142202406-142202428 TCTGAGCGGGGCCCCTGTCCTGG No data
1049358867_1049358876 12 Left 1049358867 8:142202371-142202393 CCCTCTGCCAGGCAGATCAGAGC No data
Right 1049358876 8:142202406-142202428 TCTGAGCGGGGCCCCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049358876 Original CRISPR TCTGAGCGGGGCCCCTGTCC TGG Intergenic
No off target data available for this crispr